reverse primers Search Results


86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

99
tiangen biotech co primer
Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Promega m13/puc reverse sequencing primer 2
M13/Puc Reverse Sequencing Primer 2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13/puc reverse sequencing primer 2/product/Promega
Average 90 stars, based on 1 article reviews
m13/puc reverse sequencing primer 2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega improm-ii reverse transcription kit with a random hexamer primer
Improm Ii Reverse Transcription Kit With A Random Hexamer Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/improm-ii reverse transcription kit with a random hexamer primer/product/Promega
Average 90 stars, based on 1 article reviews
improm-ii reverse transcription kit with a random hexamer primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biomics Biotechnologies forward and reverse primers
Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eton Bioscience ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca
Ndufa4 Qpcr Primer: Forward Cgcttggcactgtttaatcca, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca/product/Eton Bioscience
Average 90 stars, based on 1 article reviews
ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
LGC Biosearch reverse primer
Reverse Primer, supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/LGC Biosearch
Average 90 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent forward and reverse primers
Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega oligo (dt) primer and m-mlv reverse transcriptase
Oligo (Dt) Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo (dt) primer and m-mlv reverse transcriptase/product/Promega
Average 90 stars, based on 1 article reviews
oligo (dt) primer and m-mlv reverse transcriptase - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag reverse transcription-pcr primers
Reverse Transcription Pcr Primers, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse transcription-pcr primers/product/MWG-Biotech ag
Average 90 stars, based on 1 article reviews
reverse transcription-pcr primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega stem-loop primer reverse transcription reaction
Stem Loop Primer Reverse Transcription Reaction, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop primer reverse transcription reaction/product/Promega
Average 90 stars, based on 1 article reviews
stem-loop primer reverse transcription reaction - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results