86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
99
|
tiangen biotech co
primer Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer/product/tiangen biotech co Average 99 stars, based on 1 article reviews
primer - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
90
|
Promega
m13/puc reverse sequencing primer 2 M13/Puc Reverse Sequencing Primer 2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13/puc reverse sequencing primer 2/product/Promega Average 90 stars, based on 1 article reviews
m13/puc reverse sequencing primer 2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
improm-ii reverse transcription kit with a random hexamer primer Improm Ii Reverse Transcription Kit With A Random Hexamer Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/improm-ii reverse transcription kit with a random hexamer primer/product/Promega Average 90 stars, based on 1 article reviews
improm-ii reverse transcription kit with a random hexamer primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biomics Biotechnologies
forward and reverse primers Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eton Bioscience
ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca Ndufa4 Qpcr Primer: Forward Cgcttggcactgtttaatcca, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca/product/Eton Bioscience Average 90 stars, based on 1 article reviews
ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
LGC Biosearch
reverse primer Reverse Primer, supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer/product/LGC Biosearch Average 90 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
forward and reverse primers Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
oligo (dt) primer and m-mlv reverse transcriptase Oligo (Dt) Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligo (dt) primer and m-mlv reverse transcriptase/product/Promega Average 90 stars, based on 1 article reviews
oligo (dt) primer and m-mlv reverse transcriptase - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
reverse transcription-pcr primers Reverse Transcription Pcr Primers, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse transcription-pcr primers/product/MWG-Biotech ag Average 90 stars, based on 1 article reviews
reverse transcription-pcr primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
stem-loop primer reverse transcription reaction Stem Loop Primer Reverse Transcription Reaction, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop primer reverse transcription reaction/product/Promega Average 90 stars, based on 1 article reviews
stem-loop primer reverse transcription reaction - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |